Phis1522
Webb21 mars 2016 · Size-reduced pHIS1522 variant with sequence for C-terminal StrepII-tag fusion (including stop codon directly downstream of the tag). pN-His-TEV1622 Like … WebbPlasmid Phis1522, supplied by Mobitec, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol …
Phis1522
Did you know?
Webb1 feb. 2013 · Results: Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP) was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA). WebbpHIS1522 pSTOP1522 derivative – vector for intracellular production of His6-tagged proteins in B. megaterium this work pSTREP1525 Vector for the secretion of …
Webb载体简介. Plasmids pHIS1522/pHIS1525 both contain the strong xylA promoter (PxylA) originating from Bacillus megaterium. Transcription from this promoter is xylose … Webb10 apr. 2024 · The resulting Cediranib construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced. Generation of specific antibody Immunization of a female New Zealand rabbit was performed after standard protocol using the affinity purified immunogen TcdA1875710.
WebbEventually, mutations were introduced in pHIS1522/TcdB by site-directed mutagenesis (QuikChange, Stratagene, La Jolla, CA, USA). Cloning of TcdB constructs with internal deletions was performed in the pHIS1522 vector backbone by first introducing a silent SpeI restriction site at bp position 2542 of the TcdB sequence with the QuikChange method. Webb11 apr. 2024 · pair 5556, bases 5261556 were AGI-6780 chemical information amplified and ligated into pHis1522-TcdB1-5260 through SpeI and BamHI restriction sites. The resulting construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced.
Webb6 nov. 2008 · Results: The toxin genes tcdA and tcdB were amplified by PCR using chromosomal DNA from a toxigenic strain as a template, and cloned into a shuttle vector …
Webb6 nov. 2008 · Background Major Clostridium difficile virulence factors are the exotoxins TcdA and TcdB. Due to the large size and poor stability of the proteins, the active recombinant TcdA and TcdB have been difficult to produce. Results The toxin genes tcdA and tcdB were amplified by PCR using chromosomal DNA from a toxigenic strain as a … ontf investor relationsWebbCheck out relevant papers found by Labettor's AI that are relevant for performing Protein Expression Prokaryotic cells - Brevibacillus choshinensis SP3 α-amylase using SEC-GFP … ont fish and wildlifeWebbTherefore, pHIS1522 can be used as a versatile expression vector in both, B. megaterium and E. coli. Keywords: Bacillus megaterium / Escherichia coli / Expression vector / Xylose operon Received: December 25, 2010; revised: March 31, 2011; accepted: April 8, 2011 DOI: 10.1002/elsc.201000225 1 Introduction commonly used to control the production of … ont fire chiefsWebbTable S1. Oligonucleotides used in this study. Related to STAR Methods section. Name Sequence (5'-3') Purpose BoNTA_10R GGCCGGCATGCGGCCGGTACCCTCACTGCAGCGGACGTTCGCC ont fishing licenseWebbIf you already have clones is phis1522 for b.megateriun you can buy the brevibacillus cells from takara and test it its quite simple and fast. ionisi on the beachWebbFor production of target proteins without any tag plasmids for intracellular production (pWH1520, pMM1522, pSTOP1622) and extracellular production (pMM1525) are … ionis investor presentationWebbHuge Selection of Cloning and Expression Vectors. MoBiTec is leading in the development of unique and cutting edge vector systems for recombinant protein expression. We offer … ionis message board